Python Loops and More

class: center, middle

# More Python Loops, Arrays, and Functions

---
      #Loops and logic

Useful to walk through your data and perform logic

Testing operators

* a < b - test if something is less than
      * a > b - test if something is greater than
      * a >= b - test if something is greater than or equal
      * a > b __and__ b > c - combine logic using AND
      * a > b __or__ b > c - combine using OR
      * __not__ ( a < b ) - negate the result with NOT

---
      #Logic some more

```python
      a=1
      b=2
      if a != b:
          print "a not b"
      else:
          print "a == b"

if not (a != b):
          print "a not b"
      else:
          print "a == b"
      
      ```
      ```text
      a not b
      a == b
      ```
      
      ---
      #for loops

Reminder of how to use for to iterate through items in a list
      or in a string
      
      ```python
      dna="AAGATCAGGAC"
      for c in dna:
          print "DNA base is " + c

for c in range(len(dna)):
          print "DNA base is " + dna[c]

lst = [70,78,12]
      for n in lst:
          print "item is", n

```

---
      #Loops with while

Another way to loop is to use the while operator
      
      ```python
      # hello
      i=0
      while i < 10:
          print "i is ", i
          i += 1

```

---
      #functions

Function [info](https://docs.python.org/2/tutorial/controlflow.html#defining-functions)
      
      * def to define the function
      * can use return to inidicate the return from the routine
      
      ```python
      # code to calculate the average

def average(lst):
      """This is the average function
      """
          sum = 0;
          for n in lst:
             sum += n
          return sum / len(lst)

print average([1,2,3,4,5,100])
      ```

---
      #Regular expressions and matching
      
      Regular expressions - there are many components I will explain
      on the board, but here is the main syntax

The documentation is best [read here](https://docs.python.org/2/library/re.html)
      
      ```python
      import re
      m = re.search('(dog)', 'dogwood'):
      if m:
          print " contains dog"
          print m.group(0)

m = re.search('(d[aoe]g)', 'dogwood'):
      if m:
          print m.group(0)

m = re.search('(d[aoe]g)', 'dugwood'):
      if m:
         print m.group(0)

```
      
      ---
      #Problems

1. Write code to test if there is a stopcodon in the following
      text
      ```text
      AGAGACGAGAGTTACCGACGTAT
      ```
      2. Check and see if it is in frame?

---
      #search and replace

Using re.sub and re.subn can replace 
      ```re.sub(_pattern_,_replacement_,_string_,count_num_times_to_perform)```
      subn() can replace the same as sub() but returns the updated
      string and count of number of changes instead of updating the string      
      ```re.subn(_pattern_,_replacement_,_string_,count_num_times_to_perform)```

```python
      #replace dog with cat
      import re
      str = "My dog likes to eat dogfood"
      print str
      str2 = re.sub("dog","cat",str)
      print str2
      str3 = re.sub("cat","lion",str2,1)
      print str3
      ```
      ```text
      My dog likes to eat dogfood
      My cat likes to eat catfood
      My lion likes to eat catfood
      ```

---
      #More advanced Regex use

Regular expressions can be 'compiled' which will make them run
      faster and simply the use when you need to repeatedly search a
      pattern. For example, to enumerate the locations of all the
      sites that match
           
      ```
      import re
      motif = "\s+([Tt]he)\s+"
      message = "It was the darkest and stormiest of night. The candles were lit
      but the wind kept blowing them out. -OutTheDoor"

the_pattern = re.compile(motif)
      m = the_pattern.search(message)
      while m:
          print "matched ",m.group(1), " from ", m.start(1), " to ", m.end(1)
          m = the_pattern.search(message,m.end()+1)
      ```